Stem-loop sequence ata-MIR2118d

AccessionMI0031738 (change log)
DescriptionAegilops tauschii miR2118d stem-loop
Gene family MIPF0000745; MIR2118
Literature search

1 open access papers mention ata-MIR2118d
(1 sentences)

Stem-loop
   u  u     g            -a   ag        - u    -u    g      ua 
5'  cu agagc gugggcauggga  cau  aggaaagc c agau  ucuu gccucu  a
    || ||||| ||||||||||||  |||  |||||||| | ||||  |||| ||||||   
3'  ga ucuug uauccguacccu  gua  uccuuuug g uuug  agaa cgggga  u
   -  u     a            cc   -g        u u    uu    a      uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 22046047-22046161 [+]
intergenic
Clustered miRNAs
< 10kb from ata-MIR2118d
ata-MIR2118cchr5: 22042641-22042755 [+]
ata-MIR2118dchr5: 22046047-22046161 [+]
Database links

Mature sequence ata-miR2118d-3p

Accession MIMAT0037258
Sequence

84 - 

uuccugaugccucccaugccua

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).