Stem-loop sequence rno-mir-503-2

AccessionMI0031773 (change log)
DescriptionRattus norvegicus miR-503-2 stem-loop
Gene family MIPF0000183; mir-503
Literature search

22 open access papers mention rno-mir-503-2
(203 sentences)

Stem-loop 
        ua                 g   u a  gu 
5' ugccc  gcagcgggaacaguacu cag g gu  u
   |||||  ||||||||||||||||| ||| | ||  u
3' auggg  cgucgccuuuguuauga guc c cg  g
        uc                 g   - -  ug
Get sequence
Deep sequencing
20297 reads, 2.23 reads per million, 448 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 158584857-158584927 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-503-2
rno-mir-322-2chrX: 158584542-158584636 [+]
rno-mir-503-2chrX: 158584857-158584927 [+]
rno-mir-351-2chrX: 158585587-158585667 [+]
rno-mir-542-3chrX: 158588529-158588607 [+]
rno-mir-450b-2chrX: 158589637-158589705 [+]
Database links

Mature sequence rno-miR-503-5p

Accession MIMAT0003213
Previous IDsrno-miR-503
Sequence

6 -  

uagcagcgggaacaguacugcag

 - 28

Get sequence
Deep sequencing4252 reads, 280 experiments
Evidence experimental; cloned [1-2], SOLiD [3]

Mature sequence rno-miR-503-3p

Accession MIMAT0017224
Previous IDsrno-miR-503*
Sequence

46 -  

ggaguauuguuuccgcugccugg

 - 68

Get sequence
Deep sequencing36274 reads, 437 experiments
Evidence experimental; SOLiD [3]

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).