![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-29b-3 |
||||||||
Accession | MI0031777 (change log) | |||||||
Description | Rattus norvegicus miR-29b-3 stem-loop | |||||||
Gene family | MIPF0000009; mir-29 | |||||||
Literature search |
![]()
121 open access papers mention rno-mir-29b-3 | |||||||
Stem-loop |
- c g u uuuucc 5' cuucuggaa gcugguuuca auggug cu agau a ||||||||| |||||||||| |||||| || |||| 3' gaggauuuu ugacuaaagu uaccac ga ucua u g u - - uguuuc |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence rno-miR-29b-5p |
|
Accession | MIMAT0004717 |
Previous IDs | rno-miR-29b-2-5p |
Sequence |
11 - cugguuucacaugguggcuuag - 32 |
Deep sequencing | 13728 reads, 396 experiments |
Evidence | experimental; cloned [3], SOLiD [5] |
Mature sequence rno-miR-29b-3p |
|
Accession | MIMAT0000801 |
Previous IDs | rno-miR-29b |
Sequence |
52 - uagcaccauuugaaaucaguguu - 74 |
Deep sequencing | 2019100 reads, 495 experiments |
Evidence | experimental; cloned [1-4], SOLiD [5] |
References |
|
1 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
5 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|