Stem-loop sequence ame-mir-279d

AccessionMI0031789 (change log)
DescriptionApis mellifera miR-279d stem-loop
Gene family MIPF0000184; mir-279
Literature search

3 open access papers mention ame-mir-279d
(5 sentences)

Stem-loop
   --   gg            u  a  uc    c   uuuuuu 
5'   gau  ccuuggaugggu ug au  aguc acg      a
     |||  |||||||||||| || ||  |||| |||      u
3'   cua  ggaaccuacuca ac ua  ucag ugc      u
   ag   aa            c  c  ga    -   uuauuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000062.5: 6159794-6159875 [+]
intergenic
Database links

Mature sequence ame-miR-279d-3p

Accession MIMAT0037267
Sequence

51 - 

ugacuagauccacacucaucca

 - 72

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).