Stem-loop sequence ame-mir-3478

AccessionMI0031824 (change log)
DescriptionApis mellifera miR-3478 stem-loop
Gene family MIPF0002075; mir-3478
Stem-loop
   ag  ggaca         uc  -ac      a    uuuu 
5'   gc     uuggaugaa  cu   ccggug gguu    u
     ||     |||||||||  ||   |||||| ||||     
3'   cg     agccuacuu  ga   ggccac ccaa    u
   ga  ---ac         ua  gca      a    ccuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AMEL4.5; GCA_000002195.1) Overlapping transcripts
CM000066.5: 1395549-1395626 [+]
intergenic
Clustered miRNAs
< 10kb from ame-mir-3478
ame-mir-318CM000066.5: 1394890-1395007 [-]
ame-mir-2944CM000066.5: 1395048-1395172 [-]
ame-mir-9cCM000066.5: 1395236-1395374 [-]
ame-mir-279bCM000066.5: 1395401-1395527 [-]
ame-mir-3791CM000066.5: 1395544-1395636 [-]
ame-mir-3478CM000066.5: 1395549-1395626 [+]
Database links

Mature sequence ame-miR-3478-3p

Accession MIMAT0037302
Sequence

49 - 

cacaccggacgagauuucau

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24136738 "The integrative analysis of microRNA and mRNA expression in Apis mellifera following maze-based visual pattern learning" Qin QH, Wang ZL, Tian LQ, Gan HY, Zhang SW, Zeng ZJ Insect Sci. 21:619-636(2014).