Stem-loop sequence gma-MIR5770c

AccessionMI0032959 (change log)
DescriptionGlycine max miR5770c stem-loop
Literature search

2 open access papers mention gma-MIR5770c
(2 sentences)

Stem-loop
   -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------cuaaag        a  aug   u       u 
5'                                                                                                                                                                                                                          gugauagg cu   guu ggauuug u
                                                                                                                                                                                                                            |||||||| ||   ||| ||||||| u
3'                                                                                                                                                                                                                          uauuauuu ga   caa ucugaac c
   guauuguuggugugaagcuuguuuauuaugcuucuggaaguauucggugaaauaugguacagguagauguacauggaacgguuguuauccaauagauuuaguuagagguguguuugaggacguuuaucaggagugucgugaaagucuuaaaaucguuagugaaacuaaccaaaagguuauuaccaaggguuuuuucuuaaucuuccuuugaaaguag        a  --a   u       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr14: 44741121-44741396 [+]
intergenic
Database links

Mature sequence gma-miR5770c

Accession MIMAT0040959
Sequence

11 - 

uaggacuaugguuuggauuu

 - 30

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25465409 "An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes" Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC Plant Cell. 26:4584-4601(2014).