Stem-loop sequence gma-MIR1446

AccessionMI0032968 (change log)
DescriptionGlycine max miR1446 stem-loop
Literature search

1 open access papers mention gma-MIR1446
(1 sentences)

Stem-loop
   -auuc        c         -u       -ua  ca    uac   u   aaa  c 
5'      aacgucuu ugaacucuc  cccucaa   cu  uugc   aga aga   uu a
        |||||||| |||||||||  |||||||   ||  ||||   ||| |||   || g
3'      uugcagaa gcuugggag  gggaguu   ga  aaug   uuu ucu   aa u
   uugau        a         uu       cuc  ag    -cu   u   -gg  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gma-miR1446

Accession MIMAT0040968
Sequence

11 - 

uucugaacucucucccucaau

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25465409 "An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes" Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC Plant Cell. 26:4584-4601(2014).