Stem-loop sequence egr-mir-10231

AccessionMI0033119 (change log)
DescriptionEchinococcus granulosus miR-10231 stem-loop
Stem-loop
   -aggucgg                a   aa 
5'         gucauucugauaguuc gau  a
           |||||||||||||||| |||   
3'         cgguaaggcuaucaag cug  c
   aguuuuga                a   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000079.1: 310226-310286 [-]
intergenic
Database links

Mature sequence egr-miR-10231-5p

Accession MIMAT0041205
Sequence

6 - 

gggucauucugauaguucaga

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence egr-miR-10231-3p

Accession MIMAT0041206
Sequence

36 - 

cagaacuaucggaauggcagu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25168356 "Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus" Bai Y, Zhang Z, Jin L, Kang H, Zhu Y, Zhang L, Li X, Ma F, Zhao L, Shi B, Li J, McManus DP, Zhang W, Wang S BMC Genomics. 15:736(2014).