Stem-loop sequence egr-mir-10233

AccessionMI0033121 (change log)
DescriptionEchinococcus granulosus miR-10233 stem-loop
Stem-loop
   -------    g         uua  -       cu  u 
5'        uauu uugcacagc   ga gcucugu  gc u
          |||| |||||||||   || |||||||  || u
3'        guga agcgugucg   cu ugaggcg  cg u
   ucaaaua    a         ugg  g       uc  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000032.1: 665609-665681 [-]
intergenic
Database links

Mature sequence egr-miR-10233-5p

Accession MIMAT0041209
Sequence

6 - 

uugcacagcuuagagcucuguc

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence egr-miR-10233-3p

Accession MIMAT0041210
Sequence

40 - 

gcggagugucggugcugugcgaaagugau

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25168356 "Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus" Bai Y, Zhang Z, Jin L, Kang H, Zhu Y, Zhang L, Li X, Ma F, Zhao L, Shi B, Li J, McManus DP, Zhang W, Wang S BMC Genomics. 15:736(2014).