Stem-loop sequence egr-mir-10249

AccessionMI0033138 (change log)
DescriptionEchinococcus granulosus miR-10249 stem-loop
Stem-loop
   --aaca  g       ug    -     ua 
5'       ca caacacc  cguc ucaca  a
         || |||||||  |||| |||||   
3'       gu guugugg  gcgg ggugu  g
   gacuua  a       ug    u     ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000002.1: 2432881-2432939 [-]
intergenic
Database links

Mature sequence egr-miR-10249-5p

Accession MIMAT0041243
Sequence

6 - 

agcaacaccugcgucucacau

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence egr-miR-10249-3p

Accession MIMAT0041244
Sequence

33 - 

gugguggcggugguguugauga

 - 54

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25168356 "Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus" Bai Y, Zhang Z, Jin L, Kang H, Zhu Y, Zhang L, Li X, Ma F, Zhao L, Shi B, Li J, McManus DP, Zhang W, Wang S BMC Genomics. 15:736(2014).