Stem-loop sequence egr-mir-10251

AccessionMI0033141 (change log)
DescriptionEchinococcus granulosus miR-10251 stem-loop
Stem-loop
   --   gug          -  g a    c 
5'   gag   ccugauuuga gu c gccu a
     |||   |||||||||| || | |||| u
3'   cuu   ggacuaagcu ca g cgga g
   ac   aaa          a  g a    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000152.1: 169610-169667 [+]
intergenic
Database links

Mature sequence egr-miR-10251-5p

Accession MIMAT0041249
Sequence

6 - 

gccugauuugagugcagccu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence egr-miR-10251-3p

Accession MIMAT0041250
Sequence

33 - 

gcaggacaucgaaucaggaaa

 - 53

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25168356 "Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus" Bai Y, Zhang Z, Jin L, Kang H, Zhu Y, Zhang L, Li X, Ma F, Zhao L, Shi B, Li J, McManus DP, Zhang W, Wang S BMC Genomics. 15:736(2014).