Stem-loop sequence egr-mir-10288

AccessionMI0033179 (change log)
DescriptionEchinococcus granulosus miR-10288 stem-loop
Stem-loop
   --  g     a cu     ----a     cc      ---uc    u 
5'   ug ugugg g  guaga     uaugg  gggaac     cugc a
     || ||||| |  |||||     |||||  ||||||     |||| u
3'   ac acacc c  cgucu     guguc  cccuug     gacg c
   cu  g     - --     guaaa     -u      uuuau    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000017.1: 396344-396427 [-]
intergenic
Database links

Mature sequence egr-miR-10288-5p

Accession MIMAT0041325
Sequence

1 - 

ugguguggagcuguagaauaug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence egr-miR-10288-3p

Accession MIMAT0041326
Sequence

62 - 

ugaaaugucugccccacagcauc

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25168356 "Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus" Bai Y, Zhang Z, Jin L, Kang H, Zhu Y, Zhang L, Li X, Ma F, Zhao L, Shi B, Li J, McManus DP, Zhang W, Wang S BMC Genomics. 15:736(2014).