Stem-loop sequence egr-mir-10292

AccessionMI0033183 (change log)
DescriptionEchinococcus granulosus miR-10292 stem-loop
Stem-loop
   -aga   c        uuu     gccguaug         
5'     aug ccgcaaua   cuggc        uccuagcu 
       ||| ||||||||   |||||        ||||||| c
3'     uac ggcguugu   gaccg        gggaucgc 
   guug   u        --c     --auuguu         
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM52419v1; GCA_000524195.1) Overlapping transcripts
APAU02000387.1: 1545-1620 [-]
intergenic
Database links

Mature sequence egr-miR-10292-5p

Accession MIMAT0041333
Sequence

1 - 

agaaugcccgcaauauuucug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence egr-miR-10292-3p

Accession MIMAT0041334
Sequence

59 - 

gcuguugcggucauguug

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25168356 "Genome-wide sequencing of small RNAs reveals a tissue-specific loss of conserved microRNA families in Echinococcus granulosus" Bai Y, Zhang Z, Jin L, Kang H, Zhu Y, Zhang L, Li X, Ma F, Zhao L, Shi B, Li J, McManus DP, Zhang W, Wang S BMC Genomics. 15:736(2014).