Stem-loop sequence aga-mir-10361b

AccessionMI0033338 (change log)
DescriptionAnopheles gambiae miR-10361b stem-loop
Literature search

1 open access papers mention aga-mir-10361b
(1 sentences)

Stem-loop
   --               a       ---u   a 
5'   acacgauaagaggac guuuacg    uuc a
     ||||||||||||||| |||||||    |||  
3'   ugugcuauuuuucug uaaaugc    agg u
   ca               g       uugu   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chrX: 1722053-1722115 [+]
intergenic
Clustered miRNAs
< 10kb from aga-mir-10361b
aga-mir-10361bchrX: 1722053-1722115 [+]
aga-mir-10375achrX: 1722335-1722398 [+]
aga-mir-10375b-1chrX: 1722550-1722613 [+]
aga-mir-10361a-1chrX: 1722757-1722819 [+]
aga-mir-10375b-2chrX: 1723257-1723320 [+]
aga-mir-10361a-2chrX: 1723464-1723526 [+]
aga-mir-10355chrX: 1723972-1724033 [+]
aga-mir-10375b-3chrX: 1724403-1724466 [+]
aga-mir-10361a-3chrX: 1724610-1724672 [+]
Database links

Mature sequence aga-miR-10361b-5p

Accession MIMAT0041505
Sequence

1 - 

acacgauaagaggacaguuuacg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-10361b-3p

Accession MIMAT0041506
Sequence

41 - 

uaaauggucuuuuuaucguguac

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).