Stem-loop sequence aga-mir-2945

AccessionMI0033348 (change log)
DescriptionAnopheles gambiae miR-2945 stem-loop
Literature search

2 open access papers mention aga-mir-2945
(3 sentences)

Stem-loop
   --           a      aauaa    -----u  g 
5'   agcgagucugc cucugg     caug      cg a
     ||||||||||| ||||||     ||||      ||  
3'   uugcucagacg gagauc     guac      gc u
   gu           -      ----a    ucauau  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 10314332-10314397 [-]
intergenic
Database links

Mature sequence aga-miR-2945-5p

Accession MIMAT0041515
Sequence

1 - 

agcgagucugcacucuggaauaac

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-2945-3p

Accession MIMAT0041516
Sequence

45 - 

ugacuagaggcagacucguuug

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).