Stem-loop sequence aga-mir-33

AccessionMI0033352 (change log)
DescriptionAnopheles gambiae miR-33 stem-loop
Literature search

4 open access papers mention aga-mir-33
(11 sentences)

Stem-loop
   ---g          uu c         accg  u 
5'     ugcauuguag  g auugcacuu    ug u
       ||||||||||  | |||||||||    ||  
3'     acguaacguc  c ugacgugga    ac g
   ccca          uu a         --ca  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chrX: 1256014-1256078 [-]
intergenic
Database links

Mature sequence aga-miR-33-5p

Accession MIMAT0041523
Sequence

1 - 

gugcauuguaguugcauugca

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-33-3p

Accession MIMAT0041524
Sequence

44 - 

caguacuucugcaaugcaaccc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).