Stem-loop sequence aga-mir-980

AccessionMI0033361 (change log)
DescriptionAnopheles gambiae miR-980 stem-loop
Literature search

1 open access papers mention aga-mir-980
(1 sentences)

Stem-loop
   cg   g         u  u      aaau 
5'   guc uucauuagg ca cuagcu    u
     ||| ||||||||| || ||||||    u
3'   cgg aagugaucc gu gaucga    u
   --   g         -  c      auca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 21985899-21985956 [-]
intergenic
Database links

Mature sequence aga-miR-980-5p

Accession MIMAT0041537
Sequence

1 - 

cggucguucauuaggucaucuagc

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-980-3p

Accession MIMAT0041538
Sequence

40 - 

uagcugccuagugaagggc

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).