Stem-loop sequence aga-mir-2b

AccessionMI0033376 (change log)
DescriptionAnopheles gambiae miR-2b stem-loop
Literature search

3 open access papers mention aga-mir-2b
(16 sentences)

Stem-loop
   -uc      -         a     uccuucacugugu      a 
5'    ucaaag uggcuguga augcg             aaggga g
      |||||| ||||||||| |||||             ||||||  
3'    aguuuc accgacacu uacgc             uuuccu a
   aga      g         a     -----------uu      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 37757412-37757490 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-2b
aga-mir-2-2chr2L: 37758699-37758796 [-]
aga-mir-2cchr2L: 37758085-37758193 [-]
aga-mir-13bchr2L: 37757564-37757657 [-]
aga-mir-2bchr2L: 37757412-37757490 [-]
aga-mir-2-1chr2L: 37757103-37757189 [-]
Database links

Mature sequence aga-miR-2b-5p

Accession MIMAT0041564
Sequence

1 - 

ucucaaaguggcugugaaaug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-2b-3p

Accession MIMAT0041565
Sequence

59 - 

uaucacagccagcuuugaaga

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).