Stem-loop sequence aga-mir-31

AccessionMI0033378 (change log)
DescriptionAnopheles gambiae miR-31 stem-loop
Literature search

3 open access papers mention aga-mir-31
(4 sentences)

Stem-loop
   --u       u     c         aga 
5'    ggcaaga guugg auagcuaaa   u
      ||||||| ||||| |||||||||   u
3'    uuguucu caacu uaucgauuu   u
   uau       u     -         agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chrX: 14375923-14375980 [+]
intergenic
Database links

Mature sequence aga-miR-31-5p

Accession MIMAT0041568
Sequence

1 - 

uggcaagauguuggcauagcua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-31-3p

Accession MIMAT0041569
Sequence

36 - 

uagcuauucaacuucuuguuuau

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).