Stem-loop sequence aga-mir-2c

AccessionMI0033385 (change log)
DescriptionAnopheles gambiae miR-2c stem-loop
Literature search

2 open access papers mention aga-mir-2c
(14 sentences)

Stem-loop
   cg               -u         c    uguuuaucaccaaauaaaccg 
5'   gacugggcucaucaa  ugguugugg uaug                     g
     |||||||||||||||  ||||||||| ||||                     a
3'   cuggcucgaguaguu  accgacacu auac                     c
   gg               uu         -    uaucacuuaucgccuuuugcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2L: 37758085-37758193 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-2c
aga-mir-2-2chr2L: 37758699-37758796 [-]
aga-mir-2cchr2L: 37758085-37758193 [-]
aga-mir-13bchr2L: 37757564-37757657 [-]
aga-mir-2bchr2L: 37757412-37757490 [-]
aga-mir-2-1chr2L: 37757103-37757189 [-]
Database links

Mature sequence aga-miR-2c-5p

Accession MIMAT0041578
Sequence

9 - 

gcucaucaauugguuguggcu

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-2c-3p

Accession MIMAT0041579
Sequence

80 - 

uaucacagccauuuugaugagc

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).