Stem-loop sequence aga-mir-10377b

AccessionMI0033386 (change log)
DescriptionAnopheles gambiae miR-10377b stem-loop
Literature search

1 open access papers mention aga-mir-10377b
(1 sentences)

Stem-loop
       u                cguaaccaauaugcaagcgaucugucacaa 
5' auag uggaguuggaaauuga                              g
   |||| ||||||||||||||||                              a
3' uauc accuuaaucuuugacu                              g
       u                acuacugaguaaucuaagcgguaguuuagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr3R: 19372525-19372629 [-]
intergenic
Clustered miRNAs
< 10kb from aga-mir-10377b
aga-mir-10377achr3R: 19372881-19372972 [-]
aga-mir-10377bchr3R: 19372525-19372629 [-]
Database links

Mature sequence aga-miR-10377b-5p

Accession MIMAT0041580
Sequence

7 - 

ggaguuggaaauugacguaacc

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-10377b-3p

Accession MIMAT0041581
Sequence

79 - 

ucaucaucaguuucuaauucca

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).