Stem-loop sequence aga-mir-10378

AccessionMI0033387 (change log)
DescriptionAnopheles gambiae miR-10378 stem-loop
Literature search

1 open access papers mention aga-mir-10378
(1 sentences)

Stem-loop
         a   gu            uu      ag  guuucgcacuag 
5' ccggug ucg  uucgugguacuc  guggua  ga            c
   |||||| |||  ||||||||||||  ||||||  ||            g
3' ggucac ggc  aaguaccaugag  uacuau  cu            g
         -   ug            uu      cu  acgaaccacggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AgamP3; GCA_000005575.1) Overlapping transcripts
chr2R: 18852626-18852723 [-]
intergenic
Database links

Mature sequence aga-miR-10378-5p

Accession MIMAT0041582
Sequence

15 - 

cgugguacucuugugguaagg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-10378-3p

Accession MIMAT0041583
Sequence

66 - 

ucuaucauuugaguaccauga

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).