Stem-loop sequence gma-MIR10408

AccessionMI0033436 (change log)
DescriptionGlycine max miR10408 stem-loop
Stem-loop
   c   -uu     a    cug     -  g    acaa 
5'  ugg   uugag cuau   aaagg gu ccuc    a
    |||   ||||| ||||   ||||| || ||||    g
3'  acu   aacuc gaua   uuucc ca ggag    g
   c   uuu     a    -aa     u  -    caag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 12590738-12590810 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR10408
gma-MIR10408chr1: 12590738-12590810 [-]
gma-MIR4411chr1: 12590615-12590670 [+]
Database links

Mature sequence gma-miR10408

Accession MIMAT0041644
Sequence

42 - 

cgaggacuccuuuaaauagacu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1