Stem-loop sequence gma-MIR399j

AccessionMI0033456 (change log)
DescriptionGlycine max miR399j stem-loop
Literature search

14 open access papers mention gma-MIR399j
(86 sentences)

Stem-loop
   u         a   a          ag       -g       gagg  uug 
5'  ugaggaaug uag gcaaaucucc  uggcaga  agaagua    gc   a
    ||||||||| ||| ||||||||||  |||||||  |||||||    ||    
3'  auuuuuuac guc cguuuagagg  accguuu  ucuucgu    cg   a
   -         c   c          aa       gg       ---a  uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 35222145-35222245 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399j
gma-MIR399jchr5: 35222145-35222245 [+]
gma-MIR399dchr5: 35229349-35229451 [-]
Database links

Mature sequence gma-miR399j

Accession MIMAT0041664
Sequence

71 - 

ugccaaaggagauuugcccug

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1