Stem-loop sequence gma-MIR399k

AccessionMI0033464 (change log)
DescriptionGlycine max miR399k stem-loop
Literature search

15 open access papers mention gma-MIR399k
(88 sentences)

Stem-loop
   u         a   a          a       -ug       gagg  uug 
5'  ugaggaaug uag gcaaaucucc uuggcag   ggaagua    gc   a
    ||||||||| ||| |||||||||| |||||||   |||||||    ||    
3'  auuuuuuac guc cguuuagagg aaccguu   ucuucgu    cg   a
   -         c   c          a       ugg       ---a  uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr8: 9106143-9106243 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399k
gma-MIR399kchr8: 9106143-9106243 [+]
gma-MIR399fchr8: 9110335-9110442 [-]
Database links

Mature sequence gma-miR399k

Accession MIMAT0041672
Sequence

71 - 

ugccaaaggagauuugcccug

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1