Stem-loop sequence gma-MIR399l

AccessionMI0033470 (change log)
DescriptionGlycine max miR399l stem-loop
Literature search

14 open access papers mention gma-MIR399l
(86 sentences)

Stem-loop
   aaau             ug               aauggugauuacuuuggauuaauucagag 
5'     cauucauagggca  ucucuuuuggcaggu                             c
       |||||||||||||  |||||||||||||||                              
3'     gugagugucccgu  agaggaaaccguuca                             u
   guuc             cg               acuaaugauaaauacuccguauaaaacca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 36735539-36735666 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399l
gma-MIR399lchr9: 36735539-36735666 [+]
gma-MIR399hchr9: 36742439-36742552 [+]
Database links

Mature sequence gma-miR399l

Accession MIMAT0041678
Sequence

98 - 

ugccaaaggagagcugcccug

 - 118

Get sequence
Evidence experimental; Illumina [1]

References

1