Stem-loop sequence gma-MIR399m

AccessionMI0033473 (change log)
DescriptionGlycine max miR399m stem-loop
Literature search

14 open access papers mention gma-MIR399m
(86 sentences)

Stem-loop
   au    aau     uc       c        aaa   uc    --         u 
5'   cagc   agggc  cucucuc uggcaugu   cug  auua  uuuugguag u
     ||||   |||||  ||||||| ||||||||   |||  ||||  |||||||||  
3'   gucg   ucccg  gagaggg accguaca   gau  ugau  aaaaccauc u
   uc    guu     uu       a        -ac   ua    ug         c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 46849030-46849140 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399m
gma-MIR399achr10: 46844955-46845048 [+]
gma-MIR399mchr10: 46849030-46849140 [+]
Database links

Mature sequence gma-miR399m

Accession MIMAT0041681
Sequence

11 - 

gggcuccucucuccuggcaug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1