Stem-loop sequence gma-MIR399o

Accession

MI0033520 (change log)

Description

Glycine max miR399o stem-loop

Literature search

14 open access papers mention gma-MIR399o
(86 sentences)

Stem-loop

   au    a       uc       c       -cagacag  auua         u 
5'   cagc auagggc  cucucuc uggcaug        ac    uuuugguag u
     |||| |||||||  ||||||| |||||||        ||    |||||||||  
3'   gucg ugucccg  gagaggg accguac        ug    aaaaccauc a
   uc    g       uu       a       aacaauua  guug         c 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr20: 39357304-39357414 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from gma-MIR399o

• gma-MIR399c: chr20: 39360463-39360556 [-]
• gma-MIR399o: chr20: 39357304-39357414 [-]

Database links

• miRBase Tracker:MI0033520

Mature sequence gma-miR399o

• Accession: MIMAT0041728
• Sequence: 11 - gggcuccucucuccuggcaug - 31
• Evidence: experimental; Illumina [1]

References

1. PMID:25747880 "Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean" Zhao M, Meyers BC, Cai C, Xu W, Ma J Plant Cell. 27:546-562(2015).