Stem-loop sequence gma-MIR399o

AccessionMI0033520 (change log)
DescriptionGlycine max miR399o stem-loop
Literature search

14 open access papers mention gma-MIR399o
(86 sentences)

Stem-loop
   au    a       uc       c       -cagacag  auua         u 
5'   cagc auagggc  cucucuc uggcaug        ac    uuuugguag u
     |||| |||||||  ||||||| |||||||        ||    |||||||||  
3'   gucg ugucccg  gagaggg accguac        ug    aaaaccauc a
   uc    g       uu       a       aacaauua  guug         c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr20: 39357304-39357414 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR399o
gma-MIR399cchr20: 39360463-39360556 [-]
gma-MIR399ochr20: 39357304-39357414 [-]
Database links

Mature sequence gma-miR399o

Accession MIMAT0041728
Sequence

11 - 

gggcuccucucuccuggcaug

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1