Stem-loop sequence sfr-mir-10463

AccessionMI0033557 (change log)
DescriptionSpodoptera frugiperda miR-10463 stem-loop
Literature search

1 open access papers mention sfr-mir-10463
(1 sentences)

Stem-loop
       a   a        a  c ca             
5' uacc uuc gggauuaa gg g  acgauauguaua 
   |||| ||| |||||||| || |  ||||||||||| a
3' augg aag cccuaauu cc c  ugcuauauaugu 
       g   c        c  a ac             
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02003872.1: 8102-8174 [-]
intergenic
Clustered miRNAs
< 10kb from sfr-mir-10463
sfr-mir-10463JQCY02003872.1: 8102-8174 [-]
sfr-mir-10471JQCY02003872.1: 7015-7102 [-]
sfr-mir-10494JQCY02003872.1: 5271-5337 [-]
Database links

Mature sequence sfr-miR-10463-5p

Accession MIMAT0041796
Sequence

9 - 

agggauuaaaggcgcaacgaua

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-10463-3p

Accession MIMAT0041797
Sequence

44 - 

uaucgucacacccuuaaucccc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).