Stem-loop sequence sfr-mir-279c

AccessionMI0033569 (change log)
DescriptionSpodoptera frugiperda miR-279c stem-loop
Literature search

1 open access papers mention sfr-mir-279c
(1 sentences)

Stem-loop
    ug       u  cu      g    uucau 
5' g  ggcgagu ug  ucuggu caug     u
   |  ||||||| ||  |||||| ||||      
3' c  cugcuca ac  agauca guac     a
    gu       u  cu      -    uaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02004261.1: 8111-8173 [-]
intergenic
Clustered miRNAs
< 10kb from sfr-mir-279c
sfr-mir-279aJQCY02004261.1: 8339-8408 [-]
sfr-mir-279cJQCY02004261.1: 8111-8173 [-]
Database links

Mature sequence sfr-miR-279c-5p

Accession MIMAT0041820
Sequence

4 - 

ggcgaguuugcuucuggugcaug

 - 26

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-279c-3p

Accession MIMAT0041821
Sequence

41 - 

ugacuagauccauacucgucug

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).