Stem-loop sequence sfr-mir-10471

AccessionMI0033571 (change log)
DescriptionSpodoptera frugiperda miR-10471 stem-loop
Literature search

1 open access papers mention sfr-mir-10471
(1 sentences)

Stem-loop
            c g   c   u c  u       ua  u   a     
5' uaaacgaga c cgu cgg g uc gauuggu  cu uau caug 
   ||||||||| | ||| ||| | || |||||||  || ||| ||| c
3' auuugcucu g gua guc c ag cuaaccg  ga aua guaa 
            c a   u   c a  u       --  u   -     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02003872.1: 7015-7102 [-]
intergenic
Clustered miRNAs
< 10kb from sfr-mir-10471
sfr-mir-10463JQCY02003872.1: 8102-8174 [-]
sfr-mir-10471JQCY02003872.1: 7015-7102 [-]
sfr-mir-10494JQCY02003872.1: 5271-5337 [-]
Database links

Mature sequence sfr-miR-10471-5p

Accession MIMAT0041824
Sequence

16 - 

ccggugcucugauugguuacu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-10471-3p

Accession MIMAT0041825
Sequence

54 - 

uaggccaaucugaacccuguau

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).