Stem-loop sequence sfr-mir-92a

AccessionMI0033592 (change log)
DescriptionSpodoptera frugiperda miR-92a stem-loop
Literature search

1 open access papers mention sfr-mir-92a
(1 sentences)

Stem-loop
          g   c     -  u      c  u    u  guu 
5' ggcccgu ugg ugggc gg gacugg gc auau cg   u
   ||||||| ||| ||||| || |||||| || |||| ||   g
3' ccgggcg acc auccg cc cugacc cg uaua gc   u
          a   u     g  -      a  u    -  gug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02001369.1: 219375-219456 [-]
intergenic
Database links

Mature sequence sfr-miR-92a-5p

Accession MIMAT0041864
Sequence

14 - 

gggcggugacuggcgcuauau

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-92a-3p

Accession MIMAT0041865
Sequence

50 - 

uauugcaccagucccggccuau

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).