Stem-loop sequence sfr-mir-307

AccessionMI0033593 (change log)
DescriptionSpodoptera frugiperda miR-307 stem-loop
Literature search

1 open access papers mention sfr-mir-307
(8 sentences)

Stem-loop
   u   a    -    ua         ccu  g       u  ---   c 
5'  cuc uucc cggu  cucacucaa   gg ugugaug gu   gca u
    ||| |||| ||||  |||||||||   || ||||||| ||   ||| a
3'  gag gagg gcua  gagugaguu   cc acacuac cg   cgu g
   g   -    u    gc         ccu  a       c  gcu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02000225.1: 51944-52037 [+]
intergenic
Database links

Mature sequence sfr-miR-307-5p

Accession MIMAT0041866
Sequence

15 - 

acucacucaaccuggguguga

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-307-3p

Accession MIMAT0041867
Sequence

60 - 

ucacaaccuccuugagugagc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).