Stem-loop sequence sfr-mir-34

AccessionMI0033600 (change log)
DescriptionSpodoptera frugiperda miR-34 stem-loop
Literature search

1 open access papers mention sfr-mir-34
(1 sentences)

Stem-loop
         uc    uu        g    g         uaaa 
5' agguag  cgcg  ggcagugu guua cugguuguu    u
   ||||||  ||||  |||||||| |||| |||||||||    u
3' uccauc  gcgc  ccgucaca caau gaccgacaa    g
         gu    cu        g    -         cauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02003144.1: 38956-39039 [+]
intergenic
Clustered miRNAs
< 10kb from sfr-mir-34
sfr-mir-277-1JQCY02003144.1: 30110-30217 [+]
sfr-mir-34JQCY02003144.1: 38956-39039 [+]
Database links

Mature sequence sfr-miR-34-5p

Accession MIMAT0041878
Sequence

14 - 

uggcagugugguuagcugguugu

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-34-3p

Accession MIMAT0041879
Sequence

51 - 

cagccaguaacgacacugccuc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).