Stem-loop sequence sfr-mir-13b

AccessionMI0033607 (change log)
DescriptionSpodoptera frugiperda miR-13b stem-loop
Literature search

1 open access papers mention sfr-mir-13b
(1 sentences)

Stem-loop
   u  g       -     -             cc   u  c 
5'  cc uggccca uucgu aaaaaugguugug  aug ag u
    || ||||||| ||||| |||||||||||||  ||| ||  
3'  gg gucgggu gagca uuuuuaccgacac  uac uc g
   g  g       u     g             ua   -  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02000649.1: 55342-55420 [-]
intergenic
Clustered miRNAs
< 10kb from sfr-mir-13b
sfr-mir-2aJQCY02000649.1: 55599-55680 [-]
sfr-mir-13aJQCY02000649.1: 55432-55568 [-]
sfr-mir-13bJQCY02000649.1: 55342-55420 [-]
sfr-mir-2bJQCY02000649.1: 55212-55277 [-]
sfr-mir-2cJQCY02000649.1: 55067-55151 [-]
Database links

Mature sequence sfr-miR-13b-5p

Accession MIMAT0041892
Sequence

13 - 

ucguaaaaaugguugugccaugu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-13b-3p

Accession MIMAT0041893
Sequence

46 - 

uaucacagccauuuuugacgaguu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).