Stem-loop sequence sfr-mir-281

AccessionMI0033610 (change log)
DescriptionSpodoptera frugiperda miR-281 stem-loop
Literature search

1 open access papers mention sfr-mir-281
(1 sentences)

Stem-loop
              -ua     c      a  gc 
5' augaagagagc   uccgu gacagu uu  c
   |||||||||||   ||||| |||||| ||  a
3' uauuucucucg   aggua cuguca aa  g
              uug     -      c  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02004080.1: 4698-4760 [+]
intergenic
Database links

Mature sequence sfr-miR-281-5p

Accession MIMAT0041898
Sequence

4 - 

aagagagcuauccgucgacagu

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-281-3p

Accession MIMAT0041899
Sequence

40 - 

cugucauggaguugcucucuu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).