Stem-loop sequence sfr-mir-2756

AccessionMI0033615 (change log)
DescriptionSpodoptera frugiperda miR-2756 stem-loop
Literature search

1 open access papers mention sfr-mir-2756
(1 sentences)

Stem-loop
        g         cc      u  u      c ca  uu 
5' ggguu guagcauac  uguagc gc aagggg g  gu  u
   ||||| |||||||||  |||||| || |||||| |  ||   
3' cccag caucguaug  acaucg cg uucccc c  ca  a
        g         uu      u  u      u --  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02007677.1: 1934-2015 [-]
intergenic
Database links

Mature sequence sfr-miR-2756-5p

Accession MIMAT0041908
Sequence

14 - 

acccuguagcugcuaaggggcg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-2756-3p

Accession MIMAT0041909
Sequence

50 - 

ccccuuugcugcuacauuguau

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).