Stem-loop sequence sfr-mir-2766

AccessionMI0033619 (change log)
DescriptionSpodoptera frugiperda miR-2766 stem-loop
Literature search

1 open access papers mention sfr-mir-2766
(2 sentences)

Stem-loop
       cc     gu     c    u uc      c  ugc 
5' acgc  gucuc  ccauc uucg c  gacugg gc   u
   ||||  |||||  ||||| |||| |  |||||| ||    
3' ugcg  uagag  ggugg aagc g  cugacu cg   u
       uu     ug     u    u uu      u  caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02002242.1: 34666-34745 [-]
intergenic
Database links

Mature sequence sfr-miR-2766-5p

Accession MIMAT0041916
Sequence

14 - 

ccauccuucgucucgacuggcg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-2766-3p

Accession MIMAT0041917
Sequence

48 - 

ucagucuugucgaauggugggu

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).