Stem-loop sequence sfr-mir-10494

AccessionMI0033620 (change log)
DescriptionSpodoptera frugiperda miR-10494 stem-loop
Literature search

1 open access papers mention sfr-mir-10494
(1 sentences)

Stem-loop
        -                    aac   u 
5' auagg cgugaacaaggugggcaaug   aau u
   ||||| ||||||||||||||||||||   |||  
3' uaucc gcacuuguuccacccguuac   uua c
        u                    cuc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02003872.1: 5271-5337 [-]
intergenic
Clustered miRNAs
< 10kb from sfr-mir-10494
sfr-mir-10463JQCY02003872.1: 8102-8174 [-]
sfr-mir-10471JQCY02003872.1: 7015-7102 [-]
sfr-mir-10494JQCY02003872.1: 5271-5337 [-]
Database links

Mature sequence sfr-miR-10494-5p

Accession MIMAT0041918
Sequence

8 - 

ugaacaaggugggcaaugaac

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-10494-3p

Accession MIMAT0041919
Sequence

40 - 

uccauugcccaccuuguucacg

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).