Stem-loop sequence sfr-mir-7

AccessionMI0033624 (change log)
DescriptionSpodoptera frugiperda miR-7 stem-loop
Literature search

1 open access papers mention sfr-mir-7
(1 sentences)

Stem-loop
       ac  g    uu   a  c         --     uu ug 
5' ggcc  ac uugu  gga ga uagugauuu  uguug  u  a
   ||||  || ||||  ||| || |||||||||  |||||  |   
3' ucgg  ug aaca  ccu cu aucacuaaa  acaau  g  u
       ca  a    uc   -  a         ga     gg uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02002267.1: 91988-92072 [-]
intergenic
Database links

Mature sequence sfr-miR-7-5p

Accession MIMAT0041923
Sequence

15 - 

uggaagacuagugauuuuguu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-7-3p

Accession MIMAT0041924
Sequence

52 - 

caagaaaucacuaaucuccc

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).