Stem-loop sequence sfr-mir-279b

AccessionMI0033652 (change log)
DescriptionSpodoptera frugiperda miR-279b stem-loop
Literature search

1 open access papers mention sfr-mir-279b
(1 sentences)

Stem-loop
      a     cac   a      c    u     ua     --u  u 
5' agc gccuc   gga gauaag gaua ucuag  ucaag   ug u
   ||| |||||   ||| |||||| |||| |||||  |||||   ||  
3' ucg uggag   ucu cuauuc cuau agauc  aguuc   gc u
      c     ---   c      a    u     --     uau  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM75363v2; GCA_000753635.2) Overlapping transcripts
JQCY02000179.1: 50062-50148 [+]
intergenic
Database links

Mature sequence sfr-miR-279b-5p

Accession MIMAT0041967
Sequence

17 - 

gauaagcgauauucuaguauc

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sfr-miR-279b-3p

Accession MIMAT0041968
Sequence

55 - 

ugacuagauuaucacuuauccu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25693181 "Identification and characteristics of microRNAs from army worm, Spodoptera frugiperda cell line Sf21" Kakumani PK, Chinnappan M, Singh AK, Malhotra P, Mukherjee SK, Bhatnagar RK PLoS One. 10:e0116988(2015).