Stem-loop sequence sly-MIR172c

AccessionMI0033678 (change log)
DescriptionSolanum lycopersicum miR172c stem-loop
Literature search

28 open access papers mention sly-MIR172c
(123 sentences)

Stem-loop
   --ca a         u         a     auuuau    aau        cc    u     u      -      u 
5'     g ugcagcauc ucaagauuc cauag      auaa   auagaguu  augu ugggg gaaagu aauuaa u
       | ||||||||| ||||||||| |||||      ||||   ||||||||  |||| ||||| |||||| ||||||  
3'     c acgucguag aguucuaag guguu      uauu   uaucucgg  uaua auccu cuuuua uuaauu a
   acgg g         u         a     guuuau    agu        -u    u     -      a      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr4: 4093786-4093940 [-]
intergenic
Database links

Mature sequence sly-miR172c

Accession MIMAT0042004
Sequence

130 - 

agaaucuugaugaugcugcag

 - 150

Get sequence
Evidence experimental; Illumina [1]

References

1