Stem-loop sequence sly-MIR10529

AccessionMI0033683 (change log)
DescriptionSolanum lycopersicum miR10529 stem-loop
Stem-loop
   --aa  u    ag    a      c      uaaa  a  uc    gucuaa     -uau     ucg 
5'     ca aacg  ugag cuugcu aguugg    ac cc  cacg      ccaau    cuugg   a
       || ||||  |||| |||||| ||||||    || ||  ||||      |||||    |||||    
3'     gu uugc  acuc gaacga ucgacc    ug gg  gugu      gguug    gaacu   g
   cuuc  u    cu    c      u      ----  c  ga    aacgaa     uacu     ugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr11: 1186495-1186627 [+]
intergenic
Database links

Mature sequence sly-miR10529

Accession MIMAT0042009
Sequence

6 - 

aacgagugagacuugcucaguugg

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1