Stem-loop sequence sly-MIR530

AccessionMI0033685 (change log)
DescriptionSolanum lycopersicum miR530 stem-loop
Literature search

3 open access papers mention sly-MIR530
(7 sentences)

Stem-loop
   --uua       uu             ag  a        guu 
5'      ucugcau  gcaccugcaccuu  ug acgaauua   c
        |||||||  |||||||||||||  || ||||||||   g
3'      agacgua  uguggauguggaa  ac ugcuuaau   c
   aaaac       cu             ag  g        aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr9: 1677560-1677646 [+]
intergenic
Database links

Mature sequence sly-miR530

Accession MIMAT0042011
Sequence

62 - 

agguguagguguucaugcaga

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1