Stem-loop sequence sly-MIR10532

AccessionMI0033692 (change log)
DescriptionSolanum lycopersicum miR10532 stem-loop
Stem-loop
   --                                  uc   uag 
5'   uauguuugaaaucucagagacacacuuauacuau  uaa   g
     ||||||||||||||||||||||||||||||||||  |||    
3'   auacgggcuuuagagucucugugugaauaugaua  guu   a
   gg                                  -u   ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr1: 6382532-6382618 [+]
intergenic
Database links

Mature sequence sly-miR10532

Accession MIMAT0042018
Sequence

59 - 

aagugugucucugagauuucgggc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1