Stem-loop sequence sly-MIR10533

AccessionMI0033693 (change log)
DescriptionSolanum lycopersicum miR10533 stem-loop
Stem-loop
   -aa                    cu         a   c               aa  a       aua     -      uaa   a  a   u         u             aauaguaagaagucccgcuuc 
5'    agaucuuaugaauucuaggu  ucuuucauc gcc aauuucuucuuuuau  aa caauuga   agcuu gaaauu   caa uu uug aguuuuuga uagaagauuuaug                     u
      ||||||||||||||||||||  ||||||||| ||| |||||||||||||||  || |||||||   ||||| ||||||   ||| || ||| ||||||||| |||||||||||||                      
3'    ucuagaauacuugagauuca  agaaagugg cgg uuaaagaaggaaaua  uu guuaacu   ucgaa cuuuaa   guu aa aau ucaaaaacu aucuucuaaguau                     c
   aua                    ac         c   a               ac  c       gac     g      uuc   a  a   u         c             cucucaccagauagugaguaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr12: 1443488-1443765 [+]
intergenic
Database links

Mature sequence sly-miR10533

Accession MIMAT0042019
Sequence

6 - 

ucuuaugaauucuaggucuucu

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1