Stem-loop sequence sly-MIR10535a

AccessionMI0033696 (change log)
DescriptionSolanum lycopersicum miR10535a stem-loop
Stem-loop
   --                    g     cg   a            --            u 
5'   aaggguuggcauaaguuugu aaagc  gag uuuaggaguaaa  guacaauuauuu c
     |||||||||||||||||||| |||||  ||| ||||||||||||  ||||||||||||  
3'   uucccaaccguguuuaaaca uuucg  uuc aaauucucguuu  uauguuaauaaa g
   gu                    a     au   c            uc            c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 3441653-3441772 [-]
intergenic
Clustered miRNAs
< 10kb from sly-MIR10535a
sly-MIR10535achr8: 3441653-3441772 [-]
sly-MIR10535bchr8: 3438186-3438305 [-]
Database links

Mature sequence sly-miR10535a

Accession MIMAT0042022
Sequence

6 - 

uuggcauaaguuugugaaagccgg

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1