Stem-loop sequence sly-MIR6025

AccessionMI0033697 (change log)
DescriptionSolanum lycopersicum miR6025 stem-loop
Literature search

1 open access papers mention sly-MIR6025
(4 sentences)

Stem-loop
   --ug    a      a             u            c    ga  a  uaauu      guu 
5'     guau ccaaua uugagauaacauc agguuuaaugau uuuu  gu gc     uguaua   a
       |||| |||||| ||||||||||||| |||||||||||| ||||  || ||     ||||||   u
3'     cgua gguugu gacucuauuguag uccaaguuauua aaaa  ca cg     acaugu   u
   aaua    c      -             u            u    -a  -  --uuc      acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr4: 421941-422072 [-]
intergenic
Clustered miRNAs
< 10kb from sly-MIR6025
sly-MIR5300chr4: 423125-423389 [+]
sly-MIR6025chr4: 421941-422072 [-]
Database links

Mature sequence sly-miR6025

Accession MIMAT0042023
Sequence

6 - 

uaccaauaauugagauaacauc

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1