Stem-loop sequence sly-MIR10536

AccessionMI0033698 (change log)
DescriptionSolanum lycopersicum miR10536 stem-loop
Stem-loop
   --                          aaaggaaucgguccaaugcagcugacuaacgugcu 
5'   aaggaagcugacgauuagaacauguc                                   u
     ||||||||||||||||||||||||||                                   a
3'   uuccuucgacugcuaaucuuguacag                                   u
   uc                          auuguuucaauugauugcucaaauguugugaacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr4: 64023701-64023827 [-]
intergenic
Database links

Mature sequence sly-miR10536

Accession MIMAT0042024
Sequence

99 - 

agacauguucuaaucgucagcuuc

 - 122

Get sequence
Evidence experimental; Illumina [1]

References

1