Stem-loop sequence sly-MIR10537

AccessionMI0033699 (change log)
DescriptionSolanum lycopersicum miR10537 stem-loop
Stem-loop
   --uucu      u  gua                g        uagccuagccguggcccuggaaauacuucucugcaggacaagcuucauuuccauuaccggauaucaacagaaagg 
5'       acaacg ac   ggguaaguggauggcu aaauucgu                                                                           u
         |||||| ||   |||||||||||||||| ||||||||                                                                            
3'       uguugc ug   cccauuuaccuaccga uuuaggua                                                                           u
   gcaaac      u  aac                a        cuacuaguuagaagcuauucaaacguaaguuuagaaaggugugaggugguuuaggagauguaacaacagaaaaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 395910-396145 [+]
intergenic
Clustered miRNAs
< 10kb from sly-MIR10537
sly-MIR9470chr8: 393508-393994 [+]
sly-MIR10537chr8: 395910-396145 [+]
Database links

Mature sequence sly-miR10537

Accession MIMAT0042025
Sequence

211 - 

auuuaccccaaguucguuguc

 - 231

Get sequence
Evidence experimental; Illumina [1]

References

1